circad | circRNAs associated with diseases

circ-NT5C2
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	29383123
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	52 pairs of osteosarcoma tissue and cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGTCCTAAGTTTTCCACTTCA Reverse AG GTGCCAGTAGCATTTTAGAC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Liu, X, Zhong, Y, Li, J, Shan, A (2017). Circular RNA circ-NT5C2 acts as an oncogene in osteosarcoma proliferation and metastasis through targeting miR-448. Oncotarget, 8, 70:114829-114838.